Claudin 3 (CLDN3) (NM_001306) Human 3' UTR Clone

CAT#: SC205857

3`UTR clone of claudin 3 (CLDN3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLDN3
• Synonyms: C7orf1; CPE-R2; CPETR2; HRVP1; RVP1
• ACCN: NM_001306
• Insert Size: 385
• Sequence Data:
  Insert Sequence

  >SC205857 3'UTR clone of NM_001306
  The sequence shown below is from the reference sequence of NM_001306. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACGACCGCAAGGACTACGTCTAAGGGACAGACGCAGGGAGACCCCACCACCACCACCACCACCAACACC
  ACCACCACCACCGCGAGCTGGAGCGCGCACCAGGCCATCCAGCGTGCAGCCTTGCCTCGGAGGCCAGCCC
  ACCCCCAGAAGCCAGGAAGCCCCCGCGCTGGACTGGGGCAGCTTCCCCAGCAGCCACGGCTTTGCGGGCC
  GGGCAGTCGACTTCGGGGCCCAGGGACCAACCTGCATGGACTGTGAAACCTCACCCTTCTGGAGCACGGG
  GCCTGGGTGACCGCCAATACTTGACCACCCCGTCGAGCCCCATCGGGCCGCTGCCCCCATGCTCGCGCTG
  GGCAGGGACCGGCAGCCCTGGAAGGGGCACTTGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001306.3
• Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this intronless gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. It is also a low-affinity receptor for Clostridium perfringens enterotoxin, and shares aa sequence similarity with a putative apoptosis-related protein found in rat. [provided by RefSeq, Jul 2008]
• Locus ID: 1365