eNOS (NOS3) (NM_000603) Human 3' UTR Clone

CAT#: SC205889

3`UTR clone of nitric oxide synthase 3 (endothelial cell) (NOS3) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NOS3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NOS3
Synonyms ECNOS; eNOS
ACCN NM_000603
Insert Size 454 bp
Sequence Data
>SC205889 3'UTR clone of NM_000603
The sequence shown below is from the reference sequence of NM_000603. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGGCTCAGACACCAACAGCCCCTGAGAGCCGCCTGGCTTTCCCTTCCAGTTCCGGGAGAGCGGCTGCCCG
ACTCAGGTCCGCCCGACCAGGATCAGCCCCGCTCCTCCCCTCTTGAGGTGGTGCCTTCTCACATCTGTCC
AGAGGCTGCAAGGATTCAGCATTATTCCTCCAGGAAGGAGCAAAACGCCTCTTTTCCCTCTCTAGGCCTG
TTGCCTCGGGCCTGGGTCCGCCTTAATCTGGAAGGCCCCTCCCAGCAGCGGTACCCCAGGGCCTACTGCC
ACCCGCTTCCTGTTTCTTAGTCGAATGTTAGATTCCTCTTGCCTCTCTCAGGAGTATCTTACCTGTAAAG
TCTAATCTCTAAATCAAGTATTTATTATTGAAGATTTACCATAAGGGACTGTGCCAGATGTTAGGAGAAC
TACTAAAGTGCCTACCCCAGCTCATGTGGATTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000603.4
Summary 'Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]'
Locus ID 4846

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.