LD78 beta (CCL3L1) (NM_021006) Human 3' UTR Clone

CAT#: SC205896

3`UTR clone of chemokine (C-C motif) ligand 3-like 1 (CCL3L1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCL3L1
• Synonyms: 464.2; D17S1718; G0S19-2; LD78; LD78-beta(1-70); LD78BETA; MIP1AP; SCYA3L; SCYA3L1
• ACCN: NM_021006
• Insert Size: 430 bp
• Sequence Data:
  Insert Sequence

  >SC205896 3'UTR clone of NM_021006
  The sequence shown below is from the reference sequence of NM_021006. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTCCAGAAATACGTCAGTGACCTGGAGCTGAGTGCCTGAGGGGTCCAGAAGCTTCGAGGCCCAGCGACC
  TCAGTGGGCCCAGTGGGGAGGAGCAGGAGCCTGAGCCTTGGGAACATGCGTGTGACCTCTACAGCTACCT
  CTTCTATGGACTGGTTATTGCCAAACAGCCACACTGTGGGACTCTTCTTAACTTAAATTTTAATTTATTT
  ATACTATTTAGTTTTTATAATTTATTTTTGATTTCACAGTGTGTTTGTGATTGTTTGCTCTGAGAGTTCC
  CCCTGTCCCCTCCACCTTCCCTCACAGTGTGTCTGGTGACAACCGAGTGGCTGTCATCGGCCTGTGTAGG
  CAGTCATGGCACCAAAGCCACCAGACTGACAAATGTGTATCAGATGCTTTTGTTCAGGGCTGTGATCGGC
  CTGGGGAAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_021006.4
• Summary: 'This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility. This record represents one of two copies that are present on the ALT_REF_LOCI_2 alternate haplotype of the GRCh38 human reference genome assembly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]'
• Locus ID: 6349