N acetyl transferase 5 (NAA20) (NM_181527) Human 3' UTR Clone

CAT#: SC205898

3`UTR clone of N-acetyltransferase 5 (GCN5-related putative) (NAT5) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NAA20"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NAA20
Synonyms dJ1002M8.1; NAT3; NAT3P; NAT5; NAT5P
ACCN NM_181527
Insert Size 456
Sequence Data
>SC205898 3'UTR clone of NM_181527
The sequence shown below is from the reference sequence of NM_181527. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCATTACCTCATCCTGTGAGGCCTGAAGACATTGAATAACCCTGGGCAGTGGTTCTTAGGCAGATACTCT
AGATGCTTTATGGACAATATTATTTTCATTGGATGATTCTGGAGCTCTATTAGGAGAAAAGTAATCATTT
TAGGTCTTAAAGACTTCAAGAAAATACAGGTTATCAATTTATTTTAAATCTCATTGTTTCCAGTTAGCAA
TATCATACCTATTAAAGCTGTTCATTGTAACAAAATTCAATCAAAAAGGCAGCTAGGTCAGAAGGAAACA
TACCACTCTCATGGTTCATAGTATTCACTGTATGTATGCTAGGGAAAAGACTTGCTCCAGTCTCCTCCTC
AGTTCTGTGCCTGAGAACCACTGCTGCATATATTTGTTTTTAAATTTTGTATTGAACTGTTAATTGAAGC
TTTAAAAGCATATATGAAATGTATAAATCTAAGATG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181527.2
Summary NAT5 is a component of N-acetyltransferase complex B (NatB). Human NatB performs cotranslational N(alpha)-terminal acetylation of methionine residues when they are followed by asparagine (Starheim et al., 2008 [PubMed 18570629]). [supplied by OMIM, Apr 2009]
Locus ID 51126

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.