BTK (NM_000061) Human 3' UTR Clone

CAT#: SC205901

3`UTR clone of Bruton agammaglobulinemia tyrosine kinase (BTK) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BTK
• Synonyms: AGMX1; AT; ATK; BPK; IGHD3; IMD1; PSCTK1; XLA
• ACCN: NM_000061
• Insert Size: 431 bp
• Sequence Data:
  Insert Sequence

  >SC205901 3'UTR clone of NM_000061
  The sequence shown below is from the reference sequence of NM_000061. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATGTCATGGATGAAGAATCCTGAGCTCGCCAATAAGCTTCTTGGTTCTACTTCTCTTCTCCACAAGCCC
  CAATTTCACTTTCTCAGAGGAAATCCCAAGCTTAGGAGCCCTGGAGCCTTTGTGCTCCCACTCAATACAA
  AAAGGCCCCTCTCTACATCTGGGAATGCACCTCTTCTTTGATTCCCTGGGATAGTGGCTTCTGAGCAAAG
  GCCAAGAAATTATTGTGCCTGAAATTTCCCGAGAGAATTAAGACAGACTGAATTTGCGATGAAAATATTT
  TTTAGGAGGGAGGATGTAAATAGCCGCACAAAGGGGTCCAACAGCTCTTTGAGTAGGCATTTGGTAGAGC
  TTGGGGGTGTGTGTGTGGGGGTGGACCGAATTTGGCAAGAATGAAATGGTGTCATAAAGATGGGAGGGGA
  GGGTGTTTTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000061.2
• Summary: 'The protein encoded by this gene plays a crucial role in B-cell development. Mutations in this gene cause X-linked agammaglobulinemia type 1, which is an immunodeficiency characterized by the failure to produce mature B lymphocytes, and associated with a failure of Ig heavy chain rearrangement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2013]'
• Locus ID: 695