Betacellulin (BTC) (NM_001729) Human 3' UTR Clone

CAT#: SC205903

3`UTR clone of betacellulin (BTC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BTC
• Synonyms: betacellulin; OTTHUMP00000160600
• ACCN: NM_001729
• Insert Size: 474 bp
• Sequence Data:
  Insert Sequence

  >SC205903 3'UTR clone of NM_001729
  The sequence shown below is from the reference sequence of NM_001729. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATATAACTCCTATCAATGAAGATATTGAAGAGACAAATATTGCTTAAAAGGCTATGAAGTTACCTCCAGG
  TTGGTGGCAAGCTGCAAAGTGCCTTGCTCATTTGAAAATGGACAGAATGTGTCTCAGGAAAACAGCTAGT
  AGACATGAATTTTAAATAATGTATTTACTTTTTATTTGCAACTTTAGTTTGTGTTATTATTTTTTAATAA
  GAACATTAATTATATGTATATTGTCTAGTAATTGGGAAAAAAGCAACTGGTTAGGTAGCAACAACAGAAG
  GGAAATTTCAATAACCTTTCACTTAAGTATTGTCACCAGGATTACTAGTCAAACAAAAAAGAAAAGTAGA
  AAGGAGGTTAGGTCTTAGGAATTGAATTAATAATAAAGCTACCATTTATCAAGCATTTACCATGTGCTAA
  TAAGTTTGAAATATATTATTTCCTTTATTCCTTTCAGCAATCCATGAGATAGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001729.2
• Summary: 'This gene encodes a member of the epidermal growth factor (EGF) family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the secreted growth factor. A secreted form and a membrane-anchored form of this protein bind to multiple different EGF receptors. This protein promotes pancreatic cell proliferation and insulin secretion, as well as retinal vascular permeability. Mutations in this gene may be associated with type 2 diabetes in human patients. [provided by RefSeq, Nov 2015]'
• Locus ID: 685