CD32 (FCGR2C) (NM_201563) Human 3' UTR Clone

CAT#: SC205917

3`UTR clone of Fc fragment of IgG low affinity IIc receptor for (CD32) (FCGR2C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FCGR2C
• Synonyms: CD32; CD32C; CDW32; FCG2; FCRIIC; IGFR2
• ACCN: NM_201563
• Insert Size: 471
• Sequence Data:
  Insert Sequence

  >SC205917 3'UTR clone of NM_201563
  The sequence shown below is from the reference sequence of NM_201563. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTACCTGACTCTTCCTCCCAACGACCATGTCAACAGTAATAACTAAAGAGTAACGTTATGCCATGTGGT
  CACACTCTCAGCTTGCTGAGTGGATGACAAAAAGAGGGGAATTGTTAAAGGAAAATTTAAATGGAGACTG
  GAAAAATTCCTGAGCAAACAAAACCACCTGGCCCTTAGAAATAGCTTTAACTTTGCTTAAACTACAAACA
  CAAGCAAAACTTCACGGGGTCATACTACATACAAGCATAAGCAAAACTTAACTTGGATGATTTCTGGTAA
  ATGCTTATGTTAGAAATAAGACAACCCCAGCCAATCACAAGCAGCCTACTAACATATAATTAGGTGACTA
  GGGACTTTCTAAGAAGATACCTACCCCCAAAAAACAATTATGTAATTGAAAACCCATCGATTGCCTTTAT
  TTTGCTTCCACATTTTCCCAATAAATACTTGCCTGTGACATTTTGCCACTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_201563.4
• Summary: This gene encodes one of three members of a family of low-affinity immunoglobulin gamma Fc receptors found on the surface of many immune response cells. The encoded protein is a transmembrane glycoprotein and may be involved in phagocytosis and clearing of immune complexes. An allelic polymorphism in this gene results in both coding and non-coding variants. [provided by RefSeq, Apr 2012]
• Locus ID: 9103