PML Protein (PML) (NM_033246) Human 3' UTR Clone

CAT#: SC205918

3`UTR clone of promyelocytic leukemia (PML) transcript variant 7 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PML
Synonyms MYL; PP8675; RNF71; TRIM19
ACCN NM_033246
Insert Size 429 bp
Sequence Data
>SC205918 3'UTR clone of NM_033246
The sequence shown below is from the reference sequence of NM_033246. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGACGTTGACCTGAGGAACGCGTTGTGGTGATCAGCAGCTCGGAAGACTCAGATGCCGAAAACTCGTCCT
CCCGAGAGCTGGATGACAGCAGCAGTGAGTCCAGTGACCTCCAGCTGGAAGGCCCCAGCACCCTCAGGGT
CCTGGACGAGAACCTTGCTGACCCCCAAGCAGAAGACAGACCTCTGGTTTTCTTTGACCTCAAGATTGAC
AATGAAAGTGGGTTCTCCTGGGGCTACCCCCACCCCTTTCTAATTTAGTCTCTGAGTCCCAAAAAGAAGT
GCAGGCAGAGCCATCTGCCAGGCCCAGGAGAGCTCTGAGCTCTGGCCAACAACTGCAGCCAGGCTGGGCA
GAGCACTCCGGCTCACCTGGGCTCCTGGCGTGTCATTTGCTGGCTTGAATAAAGATGTCCGCCTTATCCA
GTGCCTGAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_033246.2
Summary 'The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
Locus ID 5371

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.