HSD3B2 (NM_001166120) Human 3' UTR Clone

CAT#: SC205919

3`UTR clone of hydroxy-delta-5-steroid dehydrogenase 3 beta- and steroid delta-isomerase 2 (HSD3B2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSD3B2
• Synonyms: HSD3B; HSDB; SDR11E2
• ACCN: NM_001166120
• Insert Size: 422 bp
• Sequence Data:
  Insert Sequence

  >SC205919 3'UTR clone of NM_001166120
  The sequence shown below is from the reference sequence of NM_001166120. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACAAGGAGACCCTGAAGTCCAAGACTCAGTGATTTAAGGATGACAGAGATGTGCATGTGGGTATTGTTA
  GGAAATGTCATCAAACTCCACCCACCTGGCTTCATACAGAAGGCAACAGGGGCACAAGCCCAGGTCCTGC
  TGCCTCTCTTTCACACAATGCCCAACTTACTGTCTTCTTCATGTCATCAAAATCTGCACAGTCACTGGCC
  CAACCAGAACTTTCTGTCCTAATCATACACCAGAAGACAAACAATATGATTTGCTGTTACCAAATCTCAG
  TGGCTGATTCTGAACAATTGTGGTCTCTCTTAACTTGAGGTTCTCTTTTGACTAATAGAGCTCCATTTCC
  CCTCTTAAATGAGAAAGCATTTCTTTTCTCTTTAATCTCCTATTCCTTCACACAGTTCAACATAAAGAGC
  AA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001166120.1
• Summary: 'The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]'
• Locus ID: 3284