STIP1 (NM_006819) Human 3' UTR Clone

CAT#: SC205937

3`UTR clone of stress-induced-phosphoprotein 1 (STIP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: STIP1
• Synonyms: HEL-S-94n; HOP; IEF-SSP-3521; P60; STI1; STI1L
• ACCN: NM_006819
• Insert Size: 455
• Sequence Data:
  Insert Sequence

  >SC205937 3'UTR clone of NM_006819
  The sequence shown below is from the reference sequence of NM_006819. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGAAGCTGATGGATGTGGGTCTGATTGCAATTCGGTGATGACTTGTTCATCCCCCCTTCCCTTCGCCCT
  CATGTGGAAAGAGGAGCTGGGACCGCGGCGAGCAGCACGGAGCGGAAGGGAGAGCAGGGGAGAGAAGGCC
  TCATCTCTCTATATTTATACATAACCCCGGGGAAGACACAGAGACTCGTACCTGCGCTGTTTGTGCCGCC
  GCTGCCTCTGGGCCCTCCCAGCACACGCATGGTCTCTTCACCGCTGCCCTCGAGTTCCATGTCTCTTTCC
  CCTGCCCCTAGTTGCTGTCTCGGCTGCTCTCCCATAGTTGGTTTTTTTTTTATTTGGGGCAGTGGGCATG
  TTATGGGGAGGGGAGGGGGTTCTTCCAGCCTCAGGTCCCAGCTGTCTCACGTTGTTTATTCTGCGTCCCC
  TTCTCCAATAAAACAAGCCAGTTGGGCGTGGTTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006819.2
• Summary: STIP1 is an adaptor protein that coordinates the functions of HSP70 (see HSPA1A; MIM 140550) and HSP90 (see HSP90AA1; MIM 140571) in protein folding. It is thought to assist in the transfer of proteins from HSP70 to HSP90 by binding both HSP90 and substrate-bound HSP70. STIP1 also stimulates the ATPase activity of HSP70 and inhibits the ATPase activity of HSP90, suggesting that it regulates both the conformations and ATPase cycles of these chaperones (Song and Masison, 2005 [PubMed 16100115]). [supplied by OMIM, Jul 2009]
• Locus ID: 10963