PEX16 (NM_057174) Human 3' UTR Clone

CAT#: SC205942

3`UTR clone of peroxisomal biogenesis factor 16 (PEX16) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PEX16
• Synonyms: PBD8A; PBD8B
• ACCN: NM_057174
• Insert Size: 437
• Sequence Data:
  Insert Sequence

  >SC205942 3'UTR clone of NM_057174
  The sequence shown below is from the reference sequence of NM_057174. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGTCGCCACCAGCGTTCCTCCCAGGACACCCTTGACTGCGCTCTCCTGTGACGATGCCACTGCAGCCCG
  CACCTTGTCACTGCTGGGCCAAGAAGCCTTCACTAGGAGTGGGATCCAGGCTCCTCTCCCACAGAAAGCG
  GTGACTTCACCTCATGGAGCCCGGGAAGCTGCTCGCCTCGGCAGCCATAGGAGCGAACACTGCTGCTCTC
  TCGCTGGCCCCTGGTGAGGACAGGAAGCCTGAACCCGGGTGATGGCTGAACGCTGCCCAGCGTGTCTTCT
  GGCTGGGGCCCTCCGTCTGCCCCTTCTCCGCAGGGCCCTGTGGCTCTGGCAGCCCCAGGCCATGGCGTTG
  CCAGCCTCCCTGTGACAGAGCCTGGTGAACAGTGAGCCTGGCTCCCACGCAAGTGGCACTTTAAGCCCTG
  CATCCTCGGTTGAGAGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_057174.2
• Summary: The protein encoded by this gene is an integral peroxisomal membrane protein. An inactivating nonsense mutation localized to this gene was observed in a patient with Zellweger syndrome of the complementation group CGD/CG9. Expression of this gene product morphologically and biochemically restores the formation of new peroxisomes, suggesting a role in peroxisome organization and biogenesis. Alternative splicing has been observed for this gene and two variants have been described. [provided by RefSeq, Jul 2008]
• Locus ID: 9409