HSPA1L (NM_005527) Human 3' UTR Clone

CAT#: SC205946

3`UTR clone of heat shock 70kDa protein 1-like (HSPA1L) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSPA1L
• Synonyms: HSP70-1L; HSP70-HOM; HSP70T; hum70t
• ACCN: NM_005527
• Insert Size: 443
• Sequence Data:
  Insert Sequence

  >SC205946 3'UTR clone of NM_005527
  The sequence shown below is from the reference sequence of NM_005527. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGAAGGCCTGCCACAGGCCCCACAATTGAAGAAGTAGATTAATTCTTTTTAGAACTGAAGCATCCTAG
  GATGCCTCTACATGTATTTCATTCCCCTCATCTTCAAACATCATTATTATTCTTGACCAGACCTGAATCT
  AAGTTACCATCCCTTGGAAATTCTGGAGAAGGAGTCTCATGCACCACCTATCACACTCCCTCACATCCTG
  TTTCTGACTTTGGAATGGACTCAGGAAAACTAGGCCCCTCTTTAAACCGTGTGATGTATTTGAATGTCTG
  TTATTTCCAGCCACCCTAACATTCTTCTTCCTGTGTGGATGCTTATTTGTCAATCAGTAAATTTGTTCGT
  AAAGAAAATTACTTCTGGTATTTAGGCTGTGAATGTACCTTGAAGGGGAGAGTTCATGGAGAGAGCATGT
  GTTCTCTGATTGTGAGGTCACTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005527.3
• Summary: This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
• Locus ID: 3305