C3AR1 (NM_004054) Human 3' UTR Clone

CAT#: SC205983

3`UTR clone of complement component 3a receptor 1 (C3AR1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C3AR1
• Synonyms: AZ3B; C3AR; HNFAG09
• ACCN: NM_004054
• Insert Size: 441 bp
• Sequence Data:
  Insert Sequence

  >SC205983 3'UTR clone of NM_004054
  The sequence shown below is from the reference sequence of NM_004054. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCAAACAATGTCATTTCAGAAAGAAATAGTACAACTGTGTGAAAATGTGGAGCAGCCAACAAGCAGGG
  GCTCTTAGGCAATCACATAGTGAAAGTTTATAAGAGGATGAAGTGATATGGTGAGCAGCGGACTTCAAAA
  ACTGTCAAAGAATCAATCCAGCGGTTCTCAAACGGTACACAGACTATTGACATCAGCATCACCTAGAAAC
  TTGTTAGAAATGCAAATTCTCAAGCCGCATCCCAGACTTGCTGAATCGGAATCTCTGGGGGTTGGGACCC
  AGCAAGGGCACTTAACAAACCCTCGTTTCTGATTAATGCTAAATGTAAGAATCATTGTAAACATTAGTTC
  TATTTCTATCCCAAACTAAGCTATGTGAAATAAGAGAAGCTACTTTGTTTTTAAATGATGTTGAATATTT
  GTCGATATTTCCATCATTAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004054.2
• Summary: 'C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]'
• Locus ID: 719