5 Lipoxygenase (ALOX5) (NM_000698) Human 3' UTR Clone

CAT#: SC205988

3`UTR clone of arachidonate 5-lipoxygenase (ALOX5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALOX5
• Synonyms: 5-LO; 5-LOX; 5LPG; LOG5
• ACCN: NM_000698
• Insert Size: 440 bp
• Sequence Data:
  Insert Sequence

  >SC205988 3'UTR clone of NM_000698
  The sequence shown below is from the reference sequence of NM_000698. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGATTCCGAACAGTGTGGCCATCTGAGCACACTGCCAGTCTCACTGTGGGAAGGCCAGCTGCCCCAGCC
  AGATGGACTCCAGCCTGCCTGGCAGGCTGTCTGGCCAGGCCTCTTGGCAGTCACATCTCTTCCTCCGAGG
  CCAGTACCTTTCCATTTATTCTTTGATCTTCAGGGAACTGCATAGATTGATCAAAGTGTAAACACCATAG
  GGACCCATTCTACACAGAGCAGGACTGCACAGCGTCCTGTCCACACCCAGCTCAGCATTTCCACACCAAG
  CAGCAACAGCAAATCACGACCACTGATAGATGTCTATTCTTGTTGGAGACATGGGATGATTATTTTCTGT
  TCTATTTGTGCTTAGTCCAATTCCTTGCACATAGTAGGTACCCAATTCAATTACTATTGAATGAATTAAG
  AATTGGTTGCCATAAAAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000698.2
• Summary: 'This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]'
• Locus ID: 240