TARP (NM_001003806) Human 3' UTR Clone

CAT#: SC205991

3`UTR clone of TCR gamma alternate reading frame protein (TARP) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TARP"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TARP
Synonyms CD3G; TCRG; TCRGC1; TCRGC2; TCRGV
ACCN NM_001003806
Insert Size 465 bp
Sequence Data
>SC205991 3'UTR clone of NM_001003806
The sequence shown below is from the reference sequence of NM_001003806. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTCTGCTTAGAAGAACGGCTTTCTGCTGCAATGGAGAGAAATCATAACAGACGGTGGCACAAGGAGGCCA
TCTTTTCCTCATCGGTTATTGTCCCTAGAAGCGTCTTCTGAGGATCTAGTTGGGCTTTCTTTCTGGGTTT
GGGCCATTTCAGTTCTCATGTGTGTACTATTCTATCATTATTGTATAACGGTTTTCAAACCAGTGGGCAC
ACAGAGAACCTCACTCTGTAATAACAATGAGGAATAGCCACGGCGATCTCCAGCACCAATCTCTCCATGT
TTTCCACAGCTCCTCCAGCCAACCCAAATAGCGCCTGCTATAGTGTAGACATCCTGCGGCTTCTAGCCTT
GTCCCTCTCTTAGTGTTCTTTAATCAGATAACTGCCTGGAAGCCTTTCATTTTACACGCCCTGAAGCAGT
CTTCTTTGCTAGTTGAATTATGTGGTGTGTTTTTCCGTAATAAGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001003806.1
Summary In some non-lymphoid tissues, the unrearranged T cell receptor gamma (TRG@) locus is expressed. The resulting transcript contains a subset of the TRG@ gene segments and is shorter than TRG@ transcripts expressed in lymphoid tissues. This RefSeq record represents the unrearranged TRG@ locus transcript; the complete TRG@ locus is represented by the genomic RefSeq NG_001336. The transcript represented by this RefSeq has two open reading frames (ORFs) that encode different proteins. The downstream ORF is in the same frame as TRG@ and its protein product is similar to TRG@ proteins. The upstream ORF uses a different reading frame and encodes a novel protein. [provided by RefSeq, Jul 2008]
Locus ID 445347

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.