CIDE C (CIDEC) (NM_022094) Human 3' UTR Clone

CAT#: SC206051

3`UTR clone of cell death-inducing DFFA-like effector c (CIDEC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CIDEC
• Synonyms: CIDE-3; CIDE3; FPLD5; FSP27
• ACCN: NM_022094
• Insert Size: 429
• Sequence Data:
  Insert Sequence

  >SC206051 3'UTR clone of NM_022094
  The sequence shown below is from the reference sequence of NM_022094. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTATCCCGACCTGTCTGAAGATACTGCAGTGAAAGCCCAAGTCCTTGGAAGCTTTCCCCAGTGAAGGAC
  TGACTGGGGGCCTCACGCTTAACTGGTAGTGCCCACAAGCCTGGCAGCTGTAGAGCCGCGAACCTCCCCA
  CACCTCCCTCACCGCGCAGGACCCTGAGTGAGGAGGAGGAGCTGGAAACCTGGGGTGGGTTGGCCAAAGG
  AGAACCTCAAGCTCCTGGCCTGATCCAGCTCCTTCCTGCCCAAGGCAGCTTAGCCCATCCAGACTGGTCC
  TGAAGTCTGTCCCTCCATTGGCATGAAGTCTGCCCCTTAGCAATCCGGCCTCGCAGGCTGTACTTTCATG
  GTGCTCTCTACCTTCTGGCCCCCATCCCGGAACATTCCTGAGTGAATTCGCAAGCGCACTAGCATGTGAT
  ATTAGGGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_022094.2
• Summary: This gene encodes a member of the cell death-inducing DNA fragmentation factor-like effector family. Members of this family play important roles in apoptosis. The encoded protein promotes lipid droplet formation in adipocytes and may mediate adipocyte apoptosis. This gene is regulated by insulin and its expression is positively correlated with insulin sensitivity. Mutations in this gene may contribute to insulin resistant diabetes. A pseudogene of this gene is located on the short arm of chromosome 3. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
• Locus ID: 63924