PSMD8 (NM_002812) Human 3' UTR Clone

CAT#: SC206093

3`UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 8 (PSMD8) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSMD8"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PSMD8
Synonyms HEL-S-91n; HIP6; HYPF; Nin1p; p31; Rpn12; S14
ACCN NM_002812
Insert Size 463 bp
Sequence Data
>SC206093 3'UTR clone of NM_002812
The sequence shown below is from the reference sequence of NM_002812. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACAGGTCATCGAGTATGCCCGGCAGCTGGAGATGATCGTCTGAGCCCCCCGGGCACTGGGTGGGGCAGGG
CACGAGTTATTTAAAACAGTTACACTGCAGGGTTTCGCCCAATAAAGGTGGACTGACATTCCCTCTTCCA
GGCCCTTGTCTCCCCAGTTGGGACGGCAGAGAGACAAGTTCTTATATCTGAAGAACTTGGAGGTTTTGGG
GCATTCAGGAGTTGGAGATAGCCTCCAACTGGGTCAGCCTCTGTCTGGTGGGCATTGCTCAGGGTCTCAA
ACATGGACGCCCACTGTGGGGCCCCAGCAGCACTGTGGCCTGCAGGAGGGCATGGCCCCAGGTAGGGGGA
CTGTTCTAGCCAGCTGTGGACACATAGGAATGCTGGACCAGGGTACCAGATTTTTTCAACAAAGGGGGTG
AAGTGTCCTACTAAAAAGAATAAATGTTGGCAGTGAATTAAAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002812.4
Summary 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 1. [provided by RefSeq, Jul 2008]'
Locus ID 5714

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.