STAG3 (NM_012447) Human 3' UTR Clone

CAT#: SC206099

3`UTR clone of stromal antigen 3 (STAG3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: STAG3
• Synonyms: POF8
• ACCN: NM_012447
• Insert Size: 390
• Sequence Data:
  Insert Sequence

  >SC206099 3'UTR clone of NM_012447
  The sequence shown below is from the reference sequence of NM_012447. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACCTCTTAGATTCTACAGAGCTGGATATTGAGGATTTCTGACAGGACTCTGGGCCCCTCCCCAGCTCC
  ACTCCCTACCTCAAGAATGTGACCATTTGGAAAAGGCAAAGAGAAAAGGAGCAAAATGAAGCATTCCCCC
  AGGCTTCAGCCCTGGGCTCTGAGGGGAAAGAGTTGGGCATTGTTTTTCTAACCTAACCTTTCCCTCTGGG
  GTAGAGAAGCCGAGAGACCCTGTCCTCCCTAATGCACTGTGGCCCAGTCCCCTTGCCTTTTTCCTGTTCT
  GTTTGGAGTGGAGAAGGGCAGCACCTCTGTGTTTAATGGAAATAGCCCATAGTCTCCTGGATTTTTGGAA
  CATCTTTCTCAGCCTATTTTGTGTCCTAATGATTCGCTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012447.2
• Summary: The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
• Locus ID: 10734