SOX18 (NM_018419) Human 3' UTR Clone

CAT#: SC206116

3`UTR clone of SRY (sex determining region Y)-box 18 (SOX18) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SOX18
• Synonyms: HLTRS; HLTS
• ACCN: NM_018419
• Insert Size: 464
• Sequence Data:
  Insert Sequence

  >SC206116 3'UTR clone of NM_018419
  The sequence shown below is from the reference sequence of NM_018419. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATTACAGCGCGTGCATCTCCGGCTAGGCCGCCGGCGCCGCCCGGGTCCCTGCAGCGCTTCCTCCCGCAGC
  CCCCGCGACCGATCCGACCGCGTCGCTGCCGCTCTGCTCTCTCATACGCGTGTATGTTTGGTTCCATGTC
  ACAGCCCCCTAGGAGCCAGTGATGCTCGGCCTTGCGCCCGTTCCACCTCCCAGGCCACCCTTCCTGGGCT
  TCTGGGCCACCTGCCCTCGGGGGGCCCCTGCGAGGGTGCCTGGAGTTCCCACGTGTCCCGGGGCTTTTCC
  AGGAAGCCCGAGCCCAGGACCTGTTGGCAGAGTTGCCAGGGTTACATTTTTGAAGCACCTGCTCCTTTTC
  TTGCAGTGTATTTTCTACAACCAGATTGTATTAATATTTTTTACTTTGCCCTTTTAAAAAATATACCTAA
  TACAATATATTTAATTTTTAATTAAACTCTTAAACTTTTCTTCC
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_018419.2
• Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. This protein plays a role in hair, blood vessel, and lymphatic vessel development. Mutations in this gene have been associated with recessive and dominant forms of hypotrichosis-lymphedema-telangiectasia. [provided by RefSeq, Jul 2008]
• Locus ID: 54345