Tryptophan Hydroxylase (TPH1) (NM_004179) Human 3' UTR Clone

CAT#: SC206120

3`UTR clone of tryptophan hydroxylase 1 (TPH1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TPH1
• Synonyms: TPRH; TRPH
• ACCN: NM_004179
• Insert Size: 469 bp
• Sequence Data:
  Insert Sequence

  >SC206120 3'UTR clone of NM_004179
  The sequence shown below is from the reference sequence of NM_004179. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCAGCAGGAAGCCGAGTATCTAACAGTAGCCAGTCATCCAGGAACATTTGAGCATCAATTCGGAGGTCTG
  GGCCATCTCTTGCTTTCCTTGAACACCTGATCCTGGAGGGACAGCATCTTCTGGCCAAACAATATTATCG
  AATTCCACTACTTAAGGAATCACTAGTCTTTGAAAATTTGTACCTGGATATTCTATTTACCACTTATTTT
  TTTGTTTAGTTTTATTTCTTTTTTTTTTTGGTAGCAGCTTTAATGAGACAATTTATATACCATACAAGCC
  ACTGACCACCCATTTTTAATAGAGAAGTTGTTTGACCCAATAGATAGATCTAATCTCAGCCTAACTCTAT
  TTTCCCCAATCCTCCTTGAGTAAAATGACCCTTTAGGATCGCTTAGAATAACTTGAGGAGTATTATGGCG
  CTGACTCATATTGTTACCTAAGATCCCCTTATTTCTAAAGTATCTGTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004179.2
• Summary: 'This gene encodes a member of the aromatic amino acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene have been associated with an elevated risk for a variety of diseases and disorders, including schizophrenia, somatic anxiety, anger-related traits, bipolar disorder, suicidal behavior, addictions, and others.[provided by RefSeq, Apr 2009]'
• Locus ID: 7166