RFX3 (NM_134428) Human 3' UTR Clone

CAT#: SC206149

3`UTR clone of regulatory factor X 3 (influences HLA class II expression) (RFX3) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RFX3
• Synonyms: bA32F11.1
• ACCN: NM_134428
• Insert Size: 439 bp
• Sequence Data:
  Insert Sequence

  >SC206149 3'UTR clone of NM_134428
  The sequence shown below is from the reference sequence of NM_134428. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TATCAGACAGTGCAGCGCTACAGGAAATACCTACACTGCAGTCTAAAGAATATTAAAGCGTATTTTTCCA
  GCTTACATTAACCCTGTTGATATTGGGCTTAAGTTGAAAATTTAATAAGCCTGAAGGTCGACTGTTGTCA
  AATTCTATCTGTGCTGAACATTAACTTTTTGGAGTTGTGAAATGGAATGGGTGTATGTATTTTGCCAGAT
  CTTTTTTTTTAACGTAAACAAATTATTTGCTTCTTAATAATGAATTTTTTCCCTTAGTTTCAGGTGTCAA
  GAAGGATTTTTACAACACTTAATGTCAATGTTTTGTTTTCTTATAATTAAAAAGTAATTTACATTTTTTG
  TAGCTTAAAATATTTTATTGTTGATTGTTAGTCTTGGTGTATGATTTCATGTGTAAGTTTTTTAATTAGA
  TGCACTTCTGTGAAATATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_134428.1
• Summary: 'This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]'
• Locus ID: 5991