TAF12 (NM_001135218) Human 3' UTR Clone

CAT#: SC206169

3`UTR clone of TAF12 RNA polymerase II TATA box binding protein (TBP)-associated factor 20kDa (TAF12) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TAF12
• Synonyms: TAF2J; TAFII20
• ACCN: NM_001135218
• Insert Size: 465 bp
• Sequence Data:
  Insert Sequence

  >SC206169 3'UTR clone of NM_001135218
  The sequence shown below is from the reference sequence of NM_001135218. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGAGAATGGCATTGATCCGGAAAACAACCAAGAAATAACACACGGAAAGGTCAGGGAATGGACAGCAAT
  GTATTTGGAGATACTTGAGCTGAGAACTCAGCCATCTCATCCTTGGATTTTTTTTTTTAATGCTTTACAG
  AGAAGCATATATTTTTTATTAACAGTGCAGCAATATCTATAATGACTGAGAGGATCTGCCAAAAGAATAA
  AGCCTCCTACCCCAACTTCCGGTCCCTTTTCCCTGCCATCTCAAAGAGGAGCAATGTATCTTCCAGAGAA
  GATTTTATTTGTGGTTTATTATATAAGTGACTGAATATGGGACAAAGCATTATGGTCTTTTTGGGTAAGA
  CAGTATTAGCAGGATTTGTAAAGGGTTTTGTTTCCTTCTCCCTTCCCCTTTTCCCTGTACTTTGTAATGT
  CAGTGTTTATATGAATATGACTTTCATTTGCTTTTCCAGAATAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001135218.1
• Summary: 'Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2008]'
• Locus ID: 6883