TAF12 (NM_005644) Human 3' UTR Clone

CAT#: SC206171

3`UTR clone of TAF12 RNA polymerase II TATA box binding protein (TBP)-associated factor 20kDa (TAF12) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAF12"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TAF12
Synonyms TAF2J; TAFII20
ACCN NM_005644
Insert Size 465 bp
Sequence Data
>SC206171 3'UTR clone of NM_005644
The sequence shown below is from the reference sequence of NM_005644. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAGAATGGCATTGATCCGGAAAACAACCAAGAAATAACACACGGAAAGGTCAGGGAATGGACAGCAAT
GTATTTGGAGATACTTGAGCTGAGAACTCAGCCATCTCATCCTTGGATTTTTTTTTTTAATGCTTTACAG
AGAAGCATATATTTTTTATTAACAGTGCAGCAATATCTATAATGACTGAGAGGATCTGCCAAAAGAATAA
AGCCTCCTACCCCAACTTCCGGTCCCTTTTCCCTGCCATCTCAAAGAGGAGCAATGTATCTTCCAGAGAA
GATTTTATTTGTGGTTTATTATATAAGTGACTGAATATGGGACAAAGCATTATGGTCTTTTTGGGTAAGA
CAGTATTAGCAGGATTTGTAAAGGGTTTTGTTTCCTTCTCCCTTCCCCTTTTCCCTGTACTTTGTAATGT
CAGTGTTTATATGAATATGACTTTCATTTGCTTTTCCAGAATAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005644.3
Summary 'Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2008]'
Locus ID 6883

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.