PML Protein (PML) (NM_033250) Human 3' UTR Clone

CAT#: SC206184

3`UTR clone of promyelocytic leukemia (PML) transcript variant 11 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PML
• Synonyms: MYL; PP8675; RNF71; TRIM19
• ACCN: NM_033250
• Insert Size: 455 bp
• Sequence Data:
  Insert Sequence

  >SC206184 3'UTR clone of NM_033250
  The sequence shown below is from the reference sequence of NM_033250. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATCAGCCCAGTCCCAGGCGCCCGTCAAGCAGGCCTCTGAGAGTGCTACCCTTCTCTTGTAACCTTGCA
  GCCAACACCCCTGCCCGGCCCCTGAGCTGCCTCCTCCAGCCCATGCTCTTACAGGCCCTGCACAGAGTAG
  CACTCATTAATTCTTGGTTAAGGAATGAATCAACGAATGAATGGCTATGCATGGACCTCTGGGCAGGGAG
  ACCTGGGTCTTCTCTGGCTGAGAGGGGAAGGCTAAGGCATGGCTGAGATTCAAGCCACCATTCCAGGCCT
  CTTTGCCCAAGAAAGAAACTTCTGTCACCCTTGCACTCTCCTGTATTCTGAGTCCCTGGCCAATAGCACA
  GCCTTCCATGCCCCGACCCCCACCCCAAGCCTCTCCACTAGGCCTCTGCCAGGATCTAAGCCCATGAGCA
  CAGGGACTGGCTATCCCAAGACCTGGCAGATGTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_033250.2
• Summary: 'The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
• Locus ID: 5371