VDAC3 (NM_001135694) Human 3' UTR Clone

CAT#: SC206251

3`UTR clone of voltage-dependent anion channel 3 (VDAC3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VDAC3
• Synonyms: HD-VDAC3; VDAC-3
• ACCN: NM_001135694
• Insert Size: 472 bp
• Sequence Data:
  Insert Sequence

  >SC206251 3'UTR clone of NM_001135694
  The sequence shown below is from the reference sequence of NM_001135694. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGGTCACAAGGTTGGCTTGGGATTTGAACTGGAAGCTTAATGTGGTTTGAGGAAAGCATCAGATTTGTC
  CCTGGAAGTGAAGAGAAATGAACCCACTATGTTTTGGCCTTAAAATTCTTCTGTGAAATTTCAAAAGTGT
  GAACTTTTTATTCTTCCAAAGAATTGTAATCCTCCCCACACTGAAGTCTAGGGGTTGCGAATCCCTCCTG
  AGGGAGATGCTTGAAGGCATGCCTGGAAGTTGTCATGTTTGTGCCACGTTTCAGTTCAGTTCTGAAGTGT
  TATTAAATGTGTTCCTCAGCGACAGTGTAGCGTCATGTTAGAGGAGACGATCTGACCCACCAGTTTGTAC
  ATCACGTCCTGCATGTCCCACACCATTTTTTCATGACCTTGTAATATACTGGTCTCTGTGCTATAGTGGA
  ATCTTTGGTTTTGCATCATAGTAAAATAAAATAAACCCATCACATTTGGAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001135694.1
• Summary: 'This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]'
• Locus ID: 7419