VDAC3 (NM_005662) Human 3' UTR Clone

CAT#: SC206252

3`UTR clone of voltage-dependent anion channel 3 (VDAC3) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "VDAC3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol VDAC3
Synonyms HD-VDAC3; VDAC-3
ACCN NM_005662
Insert Size 472 bp
Sequence Data
>SC206252 3'UTR clone of NM_005662
The sequence shown below is from the reference sequence of NM_005662. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGGTCACAAGGTTGGCTTGGGATTTGAACTGGAAGCTTAATGTGGTTTGAGGAAAGCATCAGATTTGTC
CCTGGAAGTGAAGAGAAATGAACCCACTATGTTTTGGCCTTAAAATTCTTCTGTGAAATTTCAAAAGTGT
GAACTTTTTATTCTTCCAAAGAATTGTAATCCTCCCCACACTGAAGTCTAGGGGTTGCGAATCCCTCCTG
AGGGAGATGCTTGAAGGCATGCCTGGAAGTTGTCATGTTTGTGCCACGTTTCAGTTCAGTTCTGAAGTGT
TATTAAATGTGTTCCTCAGCGACAGTGTAGCGTCATGTTAGAGGAGACGATCTGACCCACCAGTTTGTAC
ATCACGTCCTGCATGTCCCACACCATTTTTTCATGACCTTGTAATATACTGGTCTCTGTGCTATAGTGGA
ATCTTTGGTTTTGCATCATAGTAAAATAAAATAAACCCATCACATTTGGAAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005662.5
Summary 'This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]'
Locus ID 7419

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.