Isoleucyl tRNA synthetase (IARS) (NM_013417) Human 3' UTR Clone

CAT#: SC206267

3`UTR clone of isoleucyl-tRNA synthetase (IARS) transcript variant long for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IARS
• Synonyms: GRIDHH; IARS1; ILERS; ILRS; IRS; PRO0785
• ACCN: NM_013417
• Insert Size: 497 bp
• Sequence Data:
  Insert Sequence

  >SC206267 3'UTR clone of NM_013417
  The sequence shown below is from the reference sequence of NM_013417. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAAGACTGTGTATGTTTCTGTGTTACCAACAACAGCAGACTTCTAGCATGTACTTATCAATGTTGTTCG
  GTCAGCCCTTCCCTAATTACACCTATCCCCTACACATACATGCACATAGACACACACATGAACACACTGA
  AGATATTTCCTTCAGGTGTGTGTAAAATATGCTGCTTGGATTGAAATTCAAATGGGATTGATTAGTCAAG
  TAACTTGAGACCTCACAGTAATCTTCACACTTAACCTTAGACACCTATGCAGTCATGTTGGGAGCAGGTT
  ACAATGTTACTTCAGCCCACAGTTTATTTCTATACTTGAGTTCTTAAGTACAGAAGATAGAAGTGATTTA
  AATGGCATAGTATATATATCATTTTCTGGCCTTTTAAAATTTATTTGAGACCTCTTGATGAAATGGACAT
  ATTATATATTTCTGCCACCTGGATTTTCCTGGATAATTTGATGGAATATTTTAAGTTTCAGTAAATCAGA
  ACAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_013417.2
• Summary: 'Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]'
• Locus ID: 3376