Bestrophin (BEST1) (NM_001139443) Human 3' UTR Clone

CAT#: SC206279

3`UTR clone of bestrophin 1 (BEST1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BEST1
• Synonyms: ARB; BEST; Best1V1Delta2; BMD; RP50; TU15B; VMD2
• ACCN: NM_001139443
• Insert Size: 455 bp
• Sequence Data:
  Insert Sequence

  >SC206279 3'UTR clone of NM_001139443
  The sequence shown below is from the reference sequence of NM_001139443. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCAGGTGAAGGAAGATGAGGTTGTGCTGACCAGAATGCTGCTGGAGAACTGCCCCAGGGCTGACAGGCC
  AGGCTTAGCTGAGCAGATGTTATCACTGGCCCCAACTTACTTTGAGCAAGGGTGGCTGACCCAAAACCAT
  GAGGTGGCAGTCAGCTGGATGACAGATGAACACTTCCCCCATAACTATTTAGGGTAGTACCCAAGCACTA
  CAGGAAAGGGTGGCAGGAACTGCCTCACTCCTAGGAACTGGTAGATGGTGAGGTTGAGGGTGTCCAGCGC
  CCTTAGGTCATTTTCTCACTGCCTGGGAACCTCACCAAAATACTTCTTGCTTCCTTGGGGTCAGCCCAAA
  GCTGTCACAAAATCAGATATTTCCCTTTATTCCAGATTTCCTGGACACTTTCACCCAATTATAAACACCC
  CACTTCAGCCCCAATCACGTGGGAGGAAGTGTAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001139443.1
• Summary: 'This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]'
• Locus ID: 7439