DHX8 (NM_004941) Human 3' UTR Clone

CAT#: SC206283

3`UTR clone of DEAH (Asp-Glu-Ala-His) box polypeptide 8 (DHX8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DHX8
• Synonyms: DDX8; Dhr2; HRH1; PRP22; PRPF22
• ACCN: NM_004941
• Insert Size: 493 bp
• Sequence Data:
  Insert Sequence

  >SC206283 3'UTR clone of NM_004941
  The sequence shown below is from the reference sequence of NM_004941. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAACCCAATGCCTGGAGAATATCTCGAGCTTTCCGACGGCGCTGAAAGGCAAGATTGTTCCTTTGCCTCT
  CCAGCAGCAGTAGCCAGGGCTTGGACTTATCGATGACAGGCTGGTCCTGAGGATACAGCTGTCCCGTGAC
  TGACTGTCTTAACTGAGCATTTTCTCAACTCGACTCTCATTTCTTCCCTGCTGGTAAAATAGAAACAGGG
  ATTTAAACCTGGCTTTGGCAAGAGCCTGCAGCCTCCATCACCCCAAGTCCTTGGGCCCAGTTGGGAGCTC
  ATATCTAACACAGAGACACATTGCATCAACTTCAAGAAAGGGACAATTTGTGCAGCTCCAGGATGGGAAG
  GTGGAGTGGGTGAGCATCTTGTGCAGGGACATGGTGAGTGCCCTGATGCCCCAGCTAGCAGGAGCTACTG
  TGCTCATCTAAAGTGTTTGCCCCACTTCCCACCCCGTCTCCAGCCCCTGTACTTTGGCTTGACCTCGTGG
  AAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004941.1
• Summary: 'This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]'
• Locus ID: 1659