PKC delta (PRKCD) (NM_212539) Human 3' UTR Clone

CAT#: SC206300

3`UTR clone of protein kinase C delta (PRKCD) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRKCD
• Synonyms: ALPS3; CVID9; MAY1; nPKC-delta; PKCD
• ACCN: NM_212539
• Insert Size: 452 bp
• Sequence Data:
  Insert Sequence

  >SC206300 3'UTR clone of NM_212539
  The sequence shown below is from the reference sequence of NM_212539. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATTCGAGCACCTCCTGGAAGATTGAGGTTCCTGGACAGATCAGGCTAGCCCTGCCCTCCACCCACACCTG
  CCCGCTCCCCACGATAAGCACCAGTGGGACTGTGGTGACTTCTGCTGCTGGCCCCGCCCCTGCCCCCAGA
  GCGTCCTTGGCTGCCGTCTGGCCGGGCTCTCATGGTACTTCCTCTGTGAACTGTGTGTGAATCTGCTTTT
  CCTCTGCCTTCGGAGGGAAATTGTAAATCCTGTGTTTCATTACTTGAATGTAGTTATCTATTGAAAATAT
  ATATTATATACATAGACATATATATATATATAATAGGCTGTATATATTGCTCAGTAGAGAAAAACCATGG
  GGGACTGGTGATATGTTGATCTTTTTCAAAAAAATATATATATGACAAAAAAAAAAAAAAAGGAGCACAA
  GCTGTTTGAACCACCAGGTTTATTTGTGTGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_212539.1
• Summary: 'The protein encoded by this gene is a member of the protein kinase C family of serine- and threonine-specific protein kinases. The encoded protein is activated by diacylglycerol and is both a tumor suppressor and a positive regulator of cell cycle progression. Also, this protein can positively or negatively regulate apoptosis. Defects in this gene are a cause of autoimmune lymphoproliferative syndrome. [provided by RefSeq, Aug 2017]'
• Locus ID: 5580