PKC delta (PRKCD) (NM_006254) Human 3' UTR Clone

CAT#: SC206302

3`UTR clone of protein kinase C delta (PRKCD) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRKCD"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PRKCD
Synonyms ALPS3; CVID9; MAY1; nPKC-delta; PKCD
ACCN NM_006254
Insert Size 452 bp
Sequence Data
>SC206302 3'UTR clone of NM_006254
The sequence shown below is from the reference sequence of NM_006254. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATTCGAGCACCTCCTGGAAGATTGAGGTTCCTGGACAGATCAGGCTAGCCCTGCCCTCCACCCACACCTG
CCCGCTCCCCACGATAAGCACCAGTGGGACTGTGGTGACTTCTGCTGCTGGCCCCGCCCCTGCCCCCAGA
GCGTCCTTGGCTGCCGTCTGGCCGGGCTCTCATGGTACTTCCTCTGTGAACTGTGTGTGAATCTGCTTTT
CCTCTGCCTTCGGAGGGAAATTGTAAATCCTGTGTTTCATTACTTGAATGTAGTTATCTATTGAAAATAT
ATATTATATACATAGACATATATATATATATAATAGGCTGTATATATTGCTCAGTAGAGAAAAACCATGG
GGGACTGGTGATATGTTGATCTTTTTCAAAAAAATATATATATGACAAAAAAAAAAAAAAAGGAGCACAA
GCTGTTTGAACCACCAGGTTTATTTGTGTGTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006254.3
Summary 'The protein encoded by this gene is a member of the protein kinase C family of serine- and threonine-specific protein kinases. The encoded protein is activated by diacylglycerol and is both a tumor suppressor and a positive regulator of cell cycle progression. Also, this protein can positively or negatively regulate apoptosis. Defects in this gene are a cause of autoimmune lymphoproliferative syndrome. [provided by RefSeq, Aug 2017]'
Locus ID 5580

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.