SLC25A6 (NM_001636) Human 3' UTR Clone

CAT#: SC206352

3`UTR clone of solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator) member 6 (SLC25A6) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SLC25A6
• Synonyms: AAC3; ANT; ANT 2; ANT 3; ANT3; ANT3Y
• ACCN: NM_001636
• Insert Size: 492 bp
• Sequence Data:
  Insert Sequence

  >SC206352 3'UTR clone of NM_001636
  The sequence shown below is from the reference sequence of NM_001636. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTCGTGCTGGTCCTGTACGACGAGCTCAAGAAGGTGATCTAAGGGCCGCGGCCTCCTCCACACACACAC
  ACACACCAGGGGAACCAAGAGAACCACGTAGAATCCTCAACCGTGCGGACCATCAACCTTCGAGAAATTC
  CAGTTGTCTTTTTCCCAGCCGCATCCTGCCTGTAGATGGCCGGGGAAGGCTCTAGAAAAGGGGCGCATTG
  CGATCCAACCATCGGCAGCCGATTCCGTGTCTTGATCACGGGGTGGGAGGGAACCGTGGCGTCCCTGCGT
  GGGGCCCATGGGTGAGACACTCCAGTACTGAGACCTAGAGTCCAGATGCTTGTAGGAGCCAAGTCGTGTT
  CTAAGTATTTATTTAAAACAAAAGAATCACGTTTTCCCATTTGTACTTCAGCGCTAGCCCCTGTTTTGCA
  CAGCCGAGTACTGGCGAGTATGTTCTATGTTGGGCCTCCTGCTGCAAAACAATAAACAGAGGACGCAGAG
  GT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001636.3
• Summary: 'This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Jun 2013]'
• Locus ID: 293