TCF21 (NM_003206) Human 3' UTR Clone

CAT#: SC206357

3`UTR clone of transcription factor 21 (TCF21) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TCF21
• Synonyms: bHLHa23; POD1
• ACCN: NM_003206
• Insert Size: 459 bp
• Sequence Data:
  Insert Sequence

  >SC206357 3'UTR clone of NM_003206
  The sequence shown below is from the reference sequence of NM_003206. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCGCTTATGTGGAACCACCGCGTCCTGACCTTGGAGGTGCGAGTCTGGGAAAGGCGCGCTCCCGGGGG
  GAGCGGGCCCCGGGAAGGCGACCCCTGCCCTCAGTGCTCTCTGTCTCTGCTTCCCCCTCGCAATGCTCCT
  CTCTCTGTCCCACCCCGCGAGAACACTTTACAACGACGAGGAGATTCGTTTCCAAACCAGAGGAGATCAA
  TTGTACTTACAAAGATTCCCATCTATTTAACTTTATTAACTTCTACCGTGAATGACTCTGCAAGCCTTGC
  TGGTCCAAGTGCAATATGTAATTATAAATATATAAATAGATAAGAGCCTATCAATGTATCTTTTGTACAA
  TATGTTGTAAAATGTAGATCATAGGATAGCTGACTTTGACAGTCACATTTATAAAGTAATTCACTTAAAG
  ATATATATTTTTTTCAAACAAGTTTTGCTACTTTTGAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003206.3
• Summary: 'TCF21 encodes a transcription factor of the basic helix-loop-helix family. The TCF21 product is mesoderm specific, and expressed in embryonic epicardium, mesenchyme-derived tissues of lung, gut, gonad, and both mesenchymal and glomerular epithelial cells in the kidney. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 6943