GSTM4 (NM_147148) Human 3' UTR Clone

CAT#: SC206369

3`UTR clone of glutathione S-transferase mu 4 (GSTM4) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTM4
• Synonyms: GSTM4-4; GTM4
• ACCN: NM_147148
• Insert Size: 498 bp
• Sequence Data:
  Insert Sequence

  >SC206369 3'UTR clone of NM_147148
  The sequence shown below is from the reference sequence of NM_147148. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTTTGAGGTTTCCTGTGGCATAATGTGATGGTCAATTTTCTGCATCAACTTGACTGGGCTAAGGGATGC
  TCAGATGGCAGGTAAAATCATTGTGCTTGTGAGGGTGTTTCCAGAAGAGATTTGCCTTTGAATCAGAAGA
  CAGCAAAGATTTCCTTCAGCAATGAAGGAGGCATCCACCAAACTGTCAGGGCCCAGAGAGAAGAAAAAGA
  CAGGAAGGGTGAATTTGACCTCTCTGACTGGGACATCCATCTCTGCCTATCCTGGGACCTCCACACTCCT
  GGTTCTCTGGCCTTCAGACTTGATCAGGGACTAACACCATCGCCTCCCACCCCCACCTTTGTTCTGAGGC
  CTTTAGCCTCTGAATGATACCACTGGCTTTCCTGCTTCTCTATCCTGCAGTCGGCAGATCATGGGACTTC
  TTCACTCCAAAATTGTGTGAGCCAATTCCCATAACAGATAGATAAATTTATAAATAAACACACAAATTTC
  CTACAGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_147148.2
• Summary: 'Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. Multiple transcript variants, each encoding a distinct protein isoform, have been identified. [provided by RefSeq, Jul 2008]'
• Locus ID: 2948