PPP2R1A (NM_014225) Human 3' UTR Clone

CAT#: SC206386

3`UTR clone of protein phosphatase 2 (formerly 2A) regulatory subunit A alpha isoform (PPP2R1A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPP2R1A
• Synonyms: MRD36; PP2A-Aalpha; PP2AA; PP2AAALPHA; PR65A
• ACCN: NM_014225
• Insert Size: 450 bp
• Sequence Data:
  Insert Sequence

  >SC206386 3'UTR clone of NM_014225
  The sequence shown below is from the reference sequence of NM_014225. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTCTGTCTCTCGCCTGATGCTGGAAGAGGAGCAAACACTGGCCTCTGGTGTCCACCCTCCAACCCCCAC
  AAGTCCCTCTTTGGGGAGACACTGGGGGGCCTTTGGCTGTCACTCCCTGTGCATGGTCTGACCCCAGGCC
  CCTTCCCCCAGCACGGTTCCTCCTCTCCCCAGCCTGGGAAGATGTCTCACTGTCCACCTCCCAACGGGCT
  AGGGGAGCACGGGGTTGGACAGGACAGTGACCTTGGGAGGAAGGGGCTACTCCGCCCACGTCAGGGAGAG
  ATGTGAGCATCCCGGGTCACTGGATCCTGCTGCTGTAATGGGAACCCCTCCCCCATTTACTTCTCCACCT
  CCCGTCCTCCCCATCATTGGTTTTTTTTTGTGTGTCAACTGTGCCGTTTTTATTTTATTCCTTTTATTTT
  CCCCCTTTTCACAGAGAAATAAAGGTCTAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_014225.4
• Summary: 'This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]'
• Locus ID: 5518