SMAD6 (NM_005585) Human 3' UTR Clone

CAT#: SC206393

3`UTR clone of SMAD family member 6 (SMAD6) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SMAD6
• Synonyms: AOVD2; HsT17432; MADH6; MADH7
• ACCN: NM_005585
• Insert Size: 462 bp
• Sequence Data:
  Insert Sequence

  >SC206393 3'UTR clone of NM_005585
  The sequence shown below is from the reference sequence of NM_005585. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAGATCCTCCTCAACAACCCCAGATAGTGGCGGCCCCGGCGGGAGGGGCGGGTGGGAGGCCGCGGCCA
  CCGCCACCTGCCGGCCTCGAGAGGGGCCGATGCCCAGAGACACAGCCCCCACGGACAAAACCCCCCAGAT
  ATCATCTACCTAGATTTAATATAAAGTTTTATATATTATATGGAAATATATATTATACTTGTAATTATGG
  AGTCATTTTTACAATGTAATTATTTATGTATGGTGCAATGTGTGTATATGGACAAAACAAGAAAGACGCA
  CTTTGGCTTATAATTCTTTCAATACAGATATATTTTCTTTCTCTTCCTCCTTCCTCTTCCTTACTTTTTA
  TATATATATATAAAGAAAATGATACAGCAGAGCTAGGTGGAAAAGCCTGGGTTTGGTGTATGGTTTTTGA
  GATATTAATGCCCAGACAAAAAGCTAATACCAGTCACTCGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005585.4
• Summary: 'The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants have been found for this gene.[provided by RefSeq, Sep 2014]'
• Locus ID: 4091