BRG1 (SMARCA4) (NM_001128846) Human 3' UTR Clone

CAT#: SC206431

3`UTR clone of SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily a member 4 (SMARCA4) transcript variant 5

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SMARCA4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SMARCA4
Synonyms BAF190; BAF190A; BRG1; CSS4; hSNF2b; MRD16; RTPS2; SNF2; SNF2L4; SNF2LB; SWI2
ACCN NM_001128846
Insert Size 492 bp
Sequence Data
>SC206431 3'UTR clone of NM_001128846
The sequence shown below is from the reference sequence of NM_001128846. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCAGGAAGTGGCAGCGAAGAAGACTGAGCCCCGACATTCCAGTCTCGACCCCGAGCCCCTCGTTCCAGAG
CTGAGATGGCATAGGCCTTAGCAGTAACGGGTAGCAGCAGATGTAGTTTCAGACTTGGAGTAAAACTGTA
TAAACAAAAGAATCTTCCATATTTATACAGCAGAGAAGCTGTAGGACTGTTTGTGACTGGCCCTGTCCTG
GCATCAGTAGCATCTGTAACAGCATTAACTGTCTTAAAGAGAGAGAGAGAGAATTCCGAATTGGGGAACA
CACGATACCTGTTTTTCTTTTCCGTTGCTGGCAGTACTGTTGCGCCGCAGTTTGGAGTCACTGTAGTTAA
GTGTGGATGCATGTGCGTCACCGTCCACTCCTCCTACTGTATTTTATTGGACAGGTCAGACTCGCCGGGG
GCCCGGCGAGGGTATGTCAGTGTCACTGGATGTCAAACAGTAATAAATTAAACCAACAACAAAACGCACA
GC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001128846.1
Summary 'The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]'
Locus ID 6597

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.