ALDH6A1 (NM_005589) Human 3' UTR Clone

CAT#: SC206441

3`UTR clone of aldehyde dehydrogenase 6 family member A1 (ALDH6A1) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALDH6A1
• Synonyms: MMSADHA; MMSDH
• ACCN: NM_005589
• Insert Size: 492 bp
• Sequence Data:
  Insert Sequence

  >SC206441 3'UTR clone of NM_005589
  The sequence shown below is from the reference sequence of NM_005589. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCTTTCCTCACCTGCTGTTGTCATGCCTACCATGGGCCGTTAGAAACAAGTTTGTTTAAGACTGACTCC
  ATCCTGAGTAATCTCCCTTTATTTTTGACCAGCTTCATTTGTCAGCTTTGCTCAGATCAGATCGATGGGA
  TTGGAATACATTGTAACTAAAATCTTCCTCAGGACTATTAACCCCCGCAAAGTTTCTATAGGGAACTGCC
  TAGTGTAACAATGAAACCAGATTTCTCACTTGCTCTTCATACTTCTATTTTGAGGTAACTGTTGTAACTA
  TGAAATGCTTATCTGAAAGTAGTGCTTAAACCTGATTTCTAAAAATTATCCCATTTTCTGATGATTTGAA
  GGGGAGAAAAGCCAGTGTATGTAAAGAAAATGTTCCAGCCAGGCGCGGTGGCTCACGCCTGTAATTCCAT
  CATTTTGGGAGGCCACAGTGGGCAGATTGCTTGAGCCCAGGAGTTGAAGAACGTGGCGAAACCCCGTATC
  TA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005589.2
• Summary: 'This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded protein is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This protein catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Methylmalonate semialdehyde dehydrogenase deficiency is characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]'
• Locus ID: 4329