Inosine triphosphate pyrophosphatase (ITPA) (NM_033453) Human 3' UTR Clone

CAT#: SC206478

3`UTR clone of inosine triphosphatase (nucleoside triphosphate pyrophosphatase) (ITPA) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ITPA
• Synonyms: C20orf37; dJ794I6.3; HLC14-06-P; ITPase; My049; NTPase
• ACCN: NM_033453
• Insert Size: 389 bp
• Sequence Data:
  Insert Sequence

  >SC206478 3'UTR clone of NM_033453
  The sequence shown below is from the reference sequence of NM_033453. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGCAGTTTGGCAGCTTGACTTCTGCAGCTGGAGGAGGCCCCTCAGGCCGGGGATCTGGGGAGGGCTAGC
  CCAAAACCTCCCGCATCGGGCAGGCACCCCCTGAAGTACTTCCTTCAGGGTTTCCCCTTTGTGAGGGTGT
  CGAGTAGCCTCACCGGCCTGTCTGGAGGAGCAGCTGGCTCTGCTCTGAGAAACTCTGGCAAGTGGACGCC
  ATTCTCTTGCCCTTAGGATTCACTGCTCTCTCCTACAGCCGCCAGGCCTGGGGTCCTGAAAGGACCTTGG
  GTGGTAAAGCTGTACTTGGTGGGAGTGAGGGCGTGGGGAGGAACCATGCAAATCGCCTTCCATGGTTTTT
  AAATGCAGTAAATAACATTTCTGGATGAGACTTGTTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_033453.2
• Summary: 'This gene encodes an inosine triphosphate pyrophosphohydrolase. The encoded protein hydrolyzes inosine triphosphate and deoxyinosine triphosphate to the monophosphate nucleotide and diphosphate. This protein, which is a member of the HAM1 NTPase protein family, is found in the cytoplasm and acts as a homodimer. Defects in the encoded protein can result in inosine triphosphate pyrophosphorylase deficiency which causes an accumulation of ITP in red blood cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]'
• Locus ID: 3704