Inosine triphosphate pyrophosphatase (ITPA) (NM_181493) Human 3' UTR Clone

CAT#: SC206479

3`UTR clone of inosine triphosphatase (nucleoside triphosphate pyrophosphatase) (ITPA) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ITPA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ITPA
Synonyms C20orf37; dJ794I6.3; HLC14-06-P; ITPase; My049; NTPase
ACCN NM_181493
Insert Size 389 bp
Sequence Data
>SC206479 3'UTR clone of NM_181493
The sequence shown below is from the reference sequence of NM_181493. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGCAGTTTGGCAGCTTGACTTCTGCAGCTGGAGGAGGCCCCTCAGGCCGGGGATCTGGGGAGGGCTAGC
CCAAAACCTCCCGCATCGGGCAGGCACCCCCTGAAGTACTTCCTTCAGGGTTTCCCCTTTGTGAGGGTGT
CGAGTAGCCTCACCGGCCTGTCTGGAGGAGCAGCTGGCTCTGCTCTGAGAAACTCTGGCAAGTGGACGCC
ATTCTCTTGCCCTTAGGATTCACTGCTCTCTCCTACAGCCGCCAGGCCTGGGGTCCTGAAAGGACCTTGG
GTGGTAAAGCTGTACTTGGTGGGAGTGAGGGCGTGGGGAGGAACCATGCAAATCGCCTTCCATGGTTTTT
AAATGCAGTAAATAACATTTCTGGATGAGACTTGTTTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_181493.1
Summary 'This gene encodes an inosine triphosphate pyrophosphohydrolase. The encoded protein hydrolyzes inosine triphosphate and deoxyinosine triphosphate to the monophosphate nucleotide and diphosphate. This protein, which is a member of the HAM1 NTPase protein family, is found in the cytoplasm and acts as a homodimer. Defects in the encoded protein can result in inosine triphosphate pyrophosphorylase deficiency which causes an accumulation of ITP in red blood cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]'
Locus ID 3704

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.