CSNK2A2 (NM_001896) Human 3' UTR Clone

CAT#: SC206485

3`UTR clone of casein kinase 2 alpha prime polypeptide (CSNK2A2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CSNK2A2
• Synonyms: CK2A2; CK2alpha'; CSNK2A1
• ACCN: NM_001896
• Insert Size: 493 bp
• Sequence Data:
  Insert Sequence

  >SC206485 3'UTR clone of NM_001896
  The sequence shown below is from the reference sequence of NM_001896. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGTGCTTTCCAGTGGTCTCACGGCAGCACGATGAAGACTGGAAAGCGACGGGTCTGTTGCGGTTCTCCC
  ACTTTTCCATAAGCAGAACAAGAACCAAATCAAACGTCTTAACGCGTATAGAGAGATCACGTTCCGTGAG
  CAGACACAAAACGGTGGCAGGTTTGGCGAGCACGAACTAGACCAAGCGAAGGGCAGCCCACCACCGTATA
  TCAAACCTCACTTCCGAATGTAAAAGGCTCACTTGCCTTTGGCTTCCTGTTGACTTCTTCCCGACCCAGA
  AAGCATGGGGAATGTGAAGGGTATGCAGAATGTTGTTGGTTACTGTTGCTCCCCGAGCCCCTCAACTCGT
  CCCGTGGCCGCCTGTTTTTCCAGCAAACCACGCTAACTAGCTGACCACAGACTCCACAGTGGGGGGACGG
  GCGCAGTATGTGGCATGGCGGCAGTTACATATTATTATTTTAAAAGTATATATTATTGAATAAAAGGTTT
  TAA
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001896.2
• Summary: 'This gene encodes the alpha', or alpha 2, catalytic subunit of the protein kinase enzyme, casein kinase 2 (CK2). Casein kinase 2 is a serine/threonine protein kinase that phosphorylates acidic proteins such as casein. It is involved in various cellular processes, including cell cycle control, apoptosis, and circadian rhythms. This heterotetrameric kinase includes two catalytic subunits, either alpha or alpha', and two regulatory beta subunits. The closely related gene paralog encoding the alpha, or alpha 1 subunit (CSNK2A1, Gene ID: 1457) is found on chromosome 20. An intronic variant in this gene (alpha 2) may be associated with leukocyte telomere length in a South Asian population. A related transcribed pseudogene is found on chromosome 11. [provided by RefSeq, Aug 2017]'
• Locus ID: 1459