TACI (TNFRSF13B) (NM_012452) Human 3' UTR Clone

CAT#: SC206510

3`UTR clone of tumor necrosis factor receptor superfamily member 13B (TNFRSF13B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TNFRSF13B
• Synonyms: CD267; CVID; CVID2; IGAD2; RYZN; TACI; TNFRSF14B
• ACCN: NM_012452
• Insert Size: 492
• Sequence Data:
  Insert Sequence

  >SC206510 3'UTR clone of NM_012452
  The sequence shown below is from the reference sequence of NM_012452. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCATTGTGTGTGTGCCTGCCCAGGAGGGGGGCCCAGGTGCATAAATGGGGGTCAGGGAGGGAAAGGAGGA
  GGGAGAGAGATGGAGAGGAGGGGAGAGAGAAAGAGAGGTGGGGAGAGGGGAGAGAGATATGAGGAGAGAG
  AGACAGAGGAGGCAGAGAGGGAGAGAAACAGAGGAGACAGAGAGGGAGAGAGAGACAGAGGGAGAGAGAG
  ACAGAGGGGAAGAGAGGCAGAGAGGGAAAGAGGCAGAGAAGGAAAGAGACAGGCAGAGAAGGAGAGAGGC
  AGAGAGGGAGAGAGGCAGAGAGGGAGAGAGGCAGAGAGACAGAGAGGGAGAGAGGGACAGAGAGAGATAG
  AGCAGGAGGTCGGGGCACTCTGAGTCCCAGTTCCCAGTGCAGCTGTAGGTCGTCATCACCTAACCACACG
  TGCAATAAAGTCCTCGTGCCTGCTGCTCACAGCCCCCGAGAGCCCCTCCTCCTGGAGAATAAAACCTTTG
  GC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012452.2
• Summary: The protein encoded by this gene is a lymphocyte-specific member of the tumor necrosis factor (TNF) receptor superfamily. It interacts with calcium-modulator and cyclophilin ligand (CAML). The protein induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
• Locus ID: 23495