PIN1 (NM_006221) Human 3' UTR Clone

CAT#: SC206526

3`UTR clone of peptidylprolyl cis/trans isomerase NIMA-interacting 1 (PIN1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIN1
• Synonyms: DOD; UBL5
• ACCN: NM_006221
• Insert Size: 480 bp
• Sequence Data:
  Insert Sequence

  >SC206526 3'UTR clone of NM_006221
  The sequence shown below is from the reference sequence of NM_006221. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCATCCTCCGCACTGAGTGAGGGTGGGGAGCCCAGGCCTGGCCTCGGGGCAGGGCAGGGCGGCTAGGCC
  GGCCAGCTCCCCCTTGCCCGCCAGCCAGTGGCCGAACCCCCCACTCCCTGCCACCGTCACACAGTATTTA
  TTGTTCCCACAATGGCTGGGAGGGGGCCCTTCCAGATTGGGGGCCCTGGGGTCCCCACTCCCTGTCCATC
  CCCAGTTGGGGCTGCGACCGCCAGATTCTCCCTTAAGGAATTGACTTCAGCAGGGGTGGGAGGCTCCCAG
  ACCCAGGGCAGTGTGGTGGGAGGGGTGTTCCAAAGAGAAGGCCTGGTCAGCAGAGCCGCCCCGTGTCCCC
  CCAGGTGCTGGAGGCAGACTCGAGGGCCGAATTGTTTCTAGTTAGGCCACGCTCCTCTGTTCAGTCGCAA
  AGGTGAACACTCATGCGGCCCAGCCATGGGCCCTCTGAGCAACTGTGCAGCACCCTTTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006221.2
• Summary: 'Peptidyl-prolyl cis/trans isomerases (PPIases) catalyze the cis/trans isomerization of peptidyl-prolyl peptide bonds. This gene encodes one of the PPIases, which specifically binds to phosphorylated ser/thr-pro motifs to catalytically regulate the post-phosphorylation conformation of its substrates. The conformational regulation catalyzed by this PPIase has a profound impact on key proteins involved in the regulation of cell growth, genotoxic and other stress responses, the immune response, induction and maintenance of pluripotency, germ cell development, neuronal differentiation, and survival. This enzyme also plays a key role in the pathogenesis of Alzheimer's disease and many cancers. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]'
• Locus ID: 5300