CD38 (NM_001775) Human 3' UTR Clone

CAT#: SC206546

3`UTR clone of CD38 molecule (CD38) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CD38
• Synonyms: ADPRC 1; ADPRC1
• ACCN: NM_001775
• Insert Size: 493 bp
• Sequence Data:
  Insert Sequence

  >SC206546 3'UTR clone of NM_001775
  The sequence shown below is from the reference sequence of NM_001775. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGAGGATTCATCTTGCACATCTGAGATCTGAGCCAGTCGCTGTGGTTGTTTTAGCTCCTTGACTCCTT
  GTGGTTTATGTCATCATACATGACTCAGCATACCTGCTGGTGCAGAGCTGAAGATTTTGGAGGGTCCTCC
  ACAATAAGGTCAATGCCAGAGACGGAAGCCTTTTTCCCCAAAGTCTTAAAATAACTTATATCATCAGCAT
  ACCTTTATTGTGATCTATCAATAGTCAAGAAAAATTATTGTATAAGATTAGAATGAAAATTGTATGTTAA
  GTTACTTCACTTTAATTCTCATGTGATCCTTTTATGTTATTTATATATTGGTAACATCCTTTCTATTGAA
  AAATCACCACACCAAACCTCTCTTATTAGAACAGGCAAGTGAAGAAAAGTGAATGCTCAAGTTTTTCAGA
  AAGCATTACATTTCCAAATGAATGACCTTGTTGCATGATGTATTTTTGTACCCTTCCTACAGATAGTCAA
  ACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001775.2
• Summary: 'The protein encoded by this gene is a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Crystal structure analysis demonstrates that the functional molecule is a dimer, with the central portion containing the catalytic site. It is used as a prognostic marker for patients with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]'
• Locus ID: 952