Phospholipase A2 (PLA2G4A) (NM_024420) Human 3' UTR Clone

CAT#: SC206556

3`UTR clone of phospholipase A2 group IVA (cytosolic calcium-dependent) (PLA2G4A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLA2G4A
• Synonyms: cPLA2; cPLA2-alpha; GURDP; PLA2G4
• ACCN: NM_024420
• Insert Size: 494 bp
• Sequence Data:
  Insert Sequence

  >SC206556 3'UTR clone of NM_024420
  The sequence shown below is from the reference sequence of NM_024420. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGGAGTTTCTAAGTAAACCCAAAGCATAGTTCATGTACTGGAAATGGCAGCAGTTTCTGATGCTGAGG
  CAGTTTGCAATCCCATGACAACTGGATTTAAAAGTACAGTACAGATAGTCGTACTGATCATGAGAGACTG
  GCTGATACTCAAAGTTGCAGTTACTTAGCTGCATGAGAATAATACTATTATAAGTTAGGTTGACAAATGA
  TGTTGATTATGTAAGGATATACTTAGCTACATTTTCAGTCAGTATGAACTTCCTGATACAAATGTAGGGA
  TATATACTGTATTTTTAAACATTTCTCACCAACTTTCTTATGTGTGTTCTTTTTAAAAATTTTTTTTCTT
  TTAAAATATTTAACAGTTCAATCTCAATAAGACCTCGCATTATGTATGAATGTTATTCACTGACTAGATT
  TATTCATACCATGAGACAACACTATTTTTATTTATATATGCATATATATACATACATGAAATAAATACAT
  CAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_024420.2
• Summary: 'This gene encodes a member of the cytosolic phospholipase A2 group IV family. The enzyme catalyzes the hydrolysis of membrane phospholipids to release arachidonic acid which is subsequently metabolized into eicosanoids. Eicosanoids, including prostaglandins and leukotrienes, are lipid-based cellular hormones that regulate hemodynamics, inflammatory responses, and other intracellular pathways. The hydrolysis reaction also produces lysophospholipids that are converted into platelet-activating factor. The enzyme is activated by increased intracellular Ca(2+) levels and phosphorylation, resulting in its translocation from the cytosol and nucleus to perinuclear membrane vesicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]'
• Locus ID: 5321