Claudin 7 (CLDN7) (NM_001307) Human 3' UTR Clone

CAT#: SC206618

3`UTR clone of claudin 7 (CLDN7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLDN7
• Synonyms: CEPTRL2; claudin-1; CLDN-7; CPETRL2; Hs.84359
• ACCN: NM_001307
• Insert Size: 462 bp
• Sequence Data:
  Insert Sequence

  >SC206618 3'UTR clone of NM_001307
  The sequence shown below is from the reference sequence of NM_001307. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCAAGGAGTATGTGTGACCTGGGATCTCCTTGCCCCAGCCTGACAGGCTATGGGAGTGTCTAGATGCCT
  GAAAGGGCCTGGGGCTGAGCTCAGCCTGTGGGCAGGGTGCCGGACAAAGGCCTCCTGGTCACTCTGTCCC
  TGCACTCCATGTATAGTCCTCTTGGGTTGGGGGTGGGGGGGTGCCGTTGGTGGGAGAGACAAAAAGAGGG
  AGAGTGTGCTTTTTGTACAGTAATAAAAAATAAGTATTGGGAAGCAGGCTTTTTTCCCTTCAGGGCCTCT
  GCTTTCCTCCCGTCCAGATCCTTGCAGGGAGCTTGGAACCTTAGTGCACCTACTTCAGTTCAGAACACTT
  AGCACCCCACTGACTCCACTGACAATTGACTAAAAGATGCAGGTGCTCGTATCTCGACATTCATTCCCAC
  CCCCCTCTTATTTAAATAGCTACCAAAGTACTTCTTTTTTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001307.4
• Summary: 'This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Differential expression of this gene has been observed in different types of malignancies, including breast cancer, ovarian cancer, hepatocellular carcinomas, urinary tumors, prostate cancer, lung cancer, head and neck cancers, thyroid carcinomas, etc.. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]'
• Locus ID: 1366