Claudin 7 (CLDN7) (NM_001307) Human 3' UTR Clone

CAT#: SC206618

3`UTR clone of claudin 7 (CLDN7) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLDN7"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CLDN7
Synonyms CEPTRL2; claudin-1; CLDN-7; CPETRL2; Hs.84359
ACCN NM_001307
Insert Size 462 bp
Sequence Data
>SC206618 3'UTR clone of NM_001307
The sequence shown below is from the reference sequence of NM_001307. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCCAAGGAGTATGTGTGACCTGGGATCTCCTTGCCCCAGCCTGACAGGCTATGGGAGTGTCTAGATGCCT
GAAAGGGCCTGGGGCTGAGCTCAGCCTGTGGGCAGGGTGCCGGACAAAGGCCTCCTGGTCACTCTGTCCC
TGCACTCCATGTATAGTCCTCTTGGGTTGGGGGTGGGGGGGTGCCGTTGGTGGGAGAGACAAAAAGAGGG
AGAGTGTGCTTTTTGTACAGTAATAAAAAATAAGTATTGGGAAGCAGGCTTTTTTCCCTTCAGGGCCTCT
GCTTTCCTCCCGTCCAGATCCTTGCAGGGAGCTTGGAACCTTAGTGCACCTACTTCAGTTCAGAACACTT
AGCACCCCACTGACTCCACTGACAATTGACTAAAAGATGCAGGTGCTCGTATCTCGACATTCATTCCCAC
CCCCCTCTTATTTAAATAGCTACCAAAGTACTTCTTTTTTAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001307.4
Summary 'This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Differential expression of this gene has been observed in different types of malignancies, including breast cancer, ovarian cancer, hepatocellular carcinomas, urinary tumors, prostate cancer, lung cancer, head and neck cancers, thyroid carcinomas, etc.. Alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, May 2010]'
Locus ID 1366

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.