PIGQ (NM_148920) Human 3' UTR Clone

CAT#: SC206642

3`UTR clone of phosphatidylinositol glycan anchor biosynthesis class Q (PIGQ) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIGQ
• Synonyms: c407A10.1; GPI1
• ACCN: NM_148920
• Insert Size: 484
• Sequence Data:
  Insert Sequence

  >SC206642 3'UTR clone of NM_148920
  The sequence shown below is from the reference sequence of NM_148920. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGAGAGGTCGCTTTGTGAAGAAACCATCAGCAGGCTGTGAGCATCGCCAGGCTGCTGTGGGGGCGGGA
  GCAGCCTCAGTGTCAAGGGCCCGCCCACTGACCCAGCCGTACCTATTCGTCCACGGTGCCCCGTAGCAGC
  AGGTCCTGCGGCCAAATCTGTCTCCCTTCATGGGCCTCCCAGGGAAGGAGGAAGCCCTGCTGTGCAGACA
  CCTCTGTGGCCCCCCAGGAGTGTGAGTGGCCTGGGGAGGGGGCCGTGGCACTGAGGCCGAAAGTGCCTGC
  CAGACGGCACGGTCTGGGTGCGGGTGTTCCCTGTGAGCCCGAGTCCGCTTCAGGAGGGGAGCCTGCAGGT
  GCCGGCTGGTGAGGGGATGACGCGCTGTGGGTGGGAGGAGGCAGCGCCCATCTCAGCAGCACCAGGACTG
  CCTGGGACTCCCTGGCAACCCAGCACCGGGGAAGCCGTCAGCTGCTGTGACAATAAAACCTGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_148920.1
• Summary: This gene is involved in the first step in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes a N-acetylglucosaminyl transferase component that is part of the complex that catalyzes transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
• Locus ID: 9091