AP2M1 (NM_004068) Human 3' UTR Clone

CAT#: SC206645

3`UTR clone of adaptor-related protein complex 2 mu 1 subunit (AP2M1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AP2M1
• Synonyms: AP50; CLAPM1; mu2
• ACCN: NM_004068
• Insert Size: 473 bp
• Sequence Data:
  Insert Sequence

  >SC206645 3'UTR clone of NM_004068
  The sequence shown below is from the reference sequence of NM_004068. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGGCATTTATGAAACTCGCTGCTAGCTGCCACTAGGCAGCTAGCCCACCTCCCCAGCCACCCTCCTCCA
  CAGGTCCAGGTGCCGCTCCCTCCCCCACCACACATCAGTGTCTCCTCCCTCCTGCTTTGCTGCCTTCCCT
  TTGCACCAGCCCGAGTCTAGGTCTGGGCCAAGCACATTACAAGTGGGACCGGTGGAGCAGCCCCTGGGCT
  CCCTGGGCAGGGGAGTTCTGAGGCTCCTGCTCTCCCATCCACCTGTCTGTCCTGGCCTAATGCCAGGCTC
  TGAGTTCTGTGACCAAAGCCAGGTGGGTTCCCTTTCCTTCCCACCCCTGTGGCCACAGCTCTGGAGTGGG
  AGGGTTGGTTGCCCCTCACCTCAGAGCTCCCCCAAAGGCCAGTAATGGATCCCCGGCCTCAGTCCCTACT
  CTGCTTTGGGATAGTGTGAGCTTCATTTTGTACACGTGTGACTTCGTCCAGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004068.3
• Summary: 'This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]'
• Locus ID: 1173