Mannose Phosphate Isomerase (MPI) (NM_002435) Human 3' UTR Clone

CAT#: SC206649

3`UTR clone of mannose phosphate isomerase (MPI) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MPI
• Synonyms: CDG1B; PMI; PMI1
• ACCN: NM_002435
• Insert Size: 501 bp
• Sequence Data:
  Insert Sequence

  >SC206649 3'UTR clone of NM_002435
  The sequence shown below is from the reference sequence of NM_002435. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TATTCCGTGCCTGCTGTCTGCTGTAAAGGCTGCAGCCTCCCCAGCTCTCCTCTGCCAGCCACCCTAAATT
  CCAGCCAACCTCACCTCCTCGGGCCCAGCTCAAGCCCCCTTCCTTGCTCTGGACCCCTTAGGTATACCCT
  GGAAGAGCTGGGGTGGGGGAGGAGGGAGCGTGAAGGTAGTGACTCCTGAACACACCCAGGTGGAACCATC
  TTTGGGGAGGAGAGGCCCGTGTGAGGGGTCTGATACTCCCTTTGTCTTCCCTCTCTACTCCTCGCTACAC
  CTGAGCCAGGCTCTTGCCAACTCTGTTCCAGCCTATGGCTTTAGGCTAGCTGTTAAATATGTGACCCAGC
  ATTAGCTCAGCATCTGTCAGAGCAAGAGACCAGGTAATTTCTAAGAACAGGGTTCTAGCGATGGGACTGC
  CCATTTCCTCAGCTGCAGAGGAGGAAAGGGAAAGGGTAGGCCTGTAGACTAACGCTGTTTACACCCTTGT
  TCTGTCAAAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002435.1
• Summary: 'Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
• Locus ID: 4351