C9orf3 (NM_032823) Human 3' UTR Clone

CAT#: SC206679

3`UTR clone of chromosome 9 open reading frame 3 (C9orf3) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "C9orf3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol C9orf3
Synonyms AOPEP; AP-O; APO; C90RF3; ONPEP
ACCN NM_032823
Insert Size 510
Sequence Data
>SC206679 3'UTR clone of NM_032823
The sequence shown below is from the reference sequence of NM_032823. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATGGATAGGTCCTCAGCCCAGGTGGTGGCCGAAATGTTATTTTAACGAGGAAAGACCACAGCAAGATTC
TTTCATTCGTCTCCTCCTAGCCTGGGGGACCAGGCTCGAACTGACCCTGGACATCAAAGGAGGGATTATG
TGGCTGCTAAAGCCATCGGCCCACAGCCCTGTTCACGTCTTGGTGCTTCTCTTTCCCAGAGGCTGGTCCC
AGCCAGGCACACACAAAAGGCAGATTCTCGTAAACGCAGCCTCCCTCCCTGGAGGCTGCCTCCTGCCCTG
GATCTGGAGTGGAGCTGCTCTGAGATTTTGAGTTCTTCTGCAGAGATGATTAAATATATCCAAGAGACAT
TGGAAAACCTGCTGAACATTTTACATTGGTCTGCTCAGCACATGGCTGGATGCGGATATTTCTATAATTC
CAGAAAGTCACACAGCTCCTCTGTATGAGACCAGTGGGCGCCATTTAAAAGAACAGGATGAGAATCTAAG
ATATATTATTAATAAATGTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032823.3
Summary This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Locus ID 84909

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.